badanie dna warszawa

Środek: wykrycie wirusa HBV (HBsAg) i kapsydu (HBcAg) w tych samych próbach przy użyciu przeciwciał poliklonalnych HBs i HBc. Spód: wykrywanie HBSP, bez (po lewej) lub z (prawą) adsorpcją anty-HBSP z białkiem bakteryjnym GST-HBSP, w komórkach transfekowanych CCL13 GFP-HBSPP (ścieżki i (3), wątrobach zakażonych HBV (ścieżki 2, 2 ., 3 i 3.) I prawidłową wątrobę (ścieżki 4 i 4.). Metody ELISA. W przypadku pośredniego testu ELISA 100 ng peptydu swoistego dla HBSP powleczono buforem węglanowym i pozostawiono na noc w temperaturze 4 ° C na 96-studzienkowych płytkach. Po zablokowaniu, 100 .l surowic kontrolnych i surowic od pacjentów z dodatnim mianem HBV, rozcieńczonych 1:20 w PBS, 0,1% Tween i 10% FCS, inkubowano przez godzinę w 37 ° C. Przemyto go PBS i 0,1% Tween i dodano anty-ludzkie przeciwciało (1: 2000), znakowanie do alkalicznej fosfatazy. Tę mieszaninę inkubowano przez 30 minut w 37 ° C. Po ujawnieniu (30 minut) tabletek p-nitrofenylofosforanu (Sigma, Deinhoften, Niemcy), wykrywanie przeprowadzono przy użyciu spektrofotometru Multiskan ustawionego na OD 405 nm (Labsystems, Cergy-pontoise, Francja). Konstrukty plazmidowe i produkcja przeciwciał. W przypadku konstruktów HBSP, PCR przeprowadzono stosując zestaw starterów umiejscowionych w pozycji 5. (ATGCCCCTATCCTATCAACAC) lub 3. (AAGCCCAAGATGATGGGA) koniec genu HBSP DNA HBV wyekstrahowanego z surowicy pobranej z przewlekłego nosiciela HBV. Produkt PCR klonowano w wektorach eukariotycznych (promotor CMV) lub prokariotycznych (pET i pGEX). Aby uzyskać białko fuzyjne GFP-HBSP, gen HBSP wstawiono do wektorów E-GFP (CLONTECH Laboratories Inc., Palo Alto, California, USA). Plazmid HBV 1.1 został opisany wcześniej (14). Przeciwciała poliklonalne anty-HBSP uzyskano po immunizacji królików i kurcząt rekombinowanym białkiem HBSP wytwarzanym w układzie bakteryjnym pET (Novagen, Madison, Wisconsin, USA) i oczyszczono na kolumnie niklowej (QIAGEN Inc., Hilden, Niemcy ). Konstrukty pCluc i pXluc (prezenty A. McLachan, The Scripps Research Institute, La Jolla, Kalifornia, USA) odpowiadające genowi lucyferazy pod kontrolą odpowiednio promotorów genu kapsydu lub HBx zostały wcześniej opisane (15). Hodowla komórek i transfekcja. Komórki wątroby HuH7 i CCL13 hodowano w DMEM uzupełnionym 10% FBS i transfekowano 10. 20 (ig wskazanego konstruktu, stosując procedurę z fosforanem wapnia. Wydajność transfekcji monitorowano przez dodanie .g plazmidu p-galaktozydazy (pCH110; Pharmacia Biotech, Freiburg, Niemcy). W celu wykrycia in-galaktozydazy in situ komórki utrwalono w 4% paraformaldehydzie (PFA), a następnie wybarwiono X-Gal. Analizę Western blot przeprowadzono na transfekowanych ekstraktach komórkowych lub tkance z biopsji wątroby sproszkowanych w buforze RIPA (12). Bloty ujawniono przy użyciu testu chemiluminescencyjnego (ECL, Amersham Life Sciences Inc., Arlington Heights, Illinois, USA). Do analizy RNA wirusa HBV, całkowite RNA ekstrahowano za pomocą Trizol (GIBCO BRL, Gaithersburg, Maryland, USA). RNA frakcjonowano na 1,5% żelu agarozo-formaldehydowym i transblokowano na błonach Hybond N +. Analizę Southern blot związku pośredniego replikacji HBV przeprowadzono zgodnie z opisem (12). Sondę HBV znakowaną 32P stosowano do hybrydyzacji Northern i Southern blot. Testy lucyferazy. Komórki HuH7 transfekowano 5 .g pCluc lub pXluc (dodano 10 .g wektora pNeo jako nośnik) lub kotransfekowano 10 .g pHBSP. Jeden mikrogram plazmidu ekspresyjnego P-galaktozydazy pCH110 również transfekowano w celu monitorowania wydajności transfekcji. Dwa dni po transfekcji komórki poddano lizie w buforze NP-40 i ekstrakty sklarowano przez krótkie odwirowanie. Standardowy test lucyferazy przeprowadzono na 50 ul klarownego supernatantu przy użyciu luminometru Lumat LB 9501 Berthold (Analytical Luminescence Laboratory, San Diego, California, USA)
[hasła pokrewne: nervocalm opinie, wakacje mikołajka chomikuj, climea test ]