Klasyfikacja komórek T w obrębie heterogenicznego autoreaktywnego repertuaru dominuje w jeździe EAE

Produkty reakcji zsekwencjonowano dla regionu CDR3 (ABI 3100 Prism; Applied Biosystems). PCR w czasie rzeczywistym. Każdy standard V i J ustalono przez amplifikację próbek, które zawierają komórki T przy użyciu specyficznych starterów V i J. Stałą ilość cDNA dla każdego rozcieńczenia każdego wzorca V, J lub m-cyklofiliny (do przodu, GGCCGATGACGAGCCC; odwrotny, TGTCTTTGGAACTTTGTCTGCAA) (250 nM na starter) amplifikowano w 25 ul iTaqSYBR Green Supermix z ROX (Bio-Rad) . Liczbę kopii sekwencji docelowej cDNA wyprowadzono z porównania zmierzonej fluorescencji z krzywą standardową. Każdą próbkę analizowano trzykrotnie. Pomiar IFN-y przez ELISA. Komórki z różnych miejsc stymulowano Ac1a9. Supernatanty zebrano po 72 godzinach i analizowano za pomocą ilościowego testu ELISA. Przechwytywanie i wykrywanie anty-mysich IFN-y przeciwciała i rekombinowaną mysią cytokinę zakupiono od BD Biosciences. Materiały uzupełniające Zobacz Uzupełniające dane Podziękowania Niniejsza praca została poparta przez National National Sclerosis Society (grant NMSS-RG5643C8T na EE Sercarz), NIH (przyznaje R01 AI042396-0 i R01 AI048077 na EE Sercarz) oraz Krajowy Instytut Badawczy Stwardnienia Rozsianego. Peter van den Elzen i Emanual Maverakis zainicjowali te badania. Dziękujemy Joan Goverman za dostarczenie myszom transgenicznym 172,10, Janel Suburu i Nazila Daneshjou za pomoc techniczną, oraz Ericowi Milnerowi za pomoc redakcyjną. Przypisy Niestandardowe skróty: CD62L, ligand CD62; Długość L9, 9-aa CDR3; MBP, podstawowe białko mieliny. Konflikt interesów: Autorzy zadeklarowali brak konfliktu interesów. Informacje referencyjne: J. Clin. Invest.117: 2176. 2185 (2007). doi: 10.1172 / JCI28277 Obecny adres Petera van den Elzena to: Wydział Patologii i Medycyny Laboratoryjnej, Uniwersytet Kolumbii Brytyjskiej, Centrum Zdrowia Dziecka i Kobiet w BC, Vancouver, Kolumbia Brytyjska, Kanada. Obecny adres Emanual Maverakis to: Department of Dermatology, University of California Davis School of Medicine, Sacramento, Kalifornia, USA.
[hasła pokrewne: tomasz pągowski wikipedia, guz neuroendokrynny, tasiemiec bąblowiec ]